Quality Of Pain Case Summary

Decent Essays
DOI: 8/12/2009. Patient is a 48-year-old female account executive who alleges neck injury aggravated by work. As per OMNI notes, the patient is status post cervical spine surgery at C5-7 on 8/8/2011.
Based on the progress report dated 09/14/16, the patient presents for neck pain radiating from neck down and right shoulder pain.
Patient rates her pain with medications as 4/10 and without medications as 7/10.
Quality of sleep is fair. Patient is active for limited hours and takes part in limited social activities. The patient is taking her medications as prescribed. She states that medications are working well. No side effects are reported. Her activity level has decreased.
Patient states cervical pain has remained relatively the same since
…show more content…
Tenderness is noted at the paracervical muscles, rhomboids and trapezius, as well as cervical paraspinal muscles. Spurling's maneuver causes pain in the muscles of the neck. There is tenderness to bilateral facets with palpation. There is pain with facet loading bilaterally.

Patient appears to be depressed and in mild-to-moderate pain.
On examination of the right shoulder, movements are restricted with flexion to 145 degrees, extension to 50 degrees, abduction to 80 degrees, internal rotation behind body to 40 degrees and external rotation to 40 degrees. Hawkins test, Neer’s test, Shoulder crossover test, Empty Can’s test and Speed’s test are positive.
The right hand is in rigid splint, 3rd and 4th finger fixed.
Motor testing is limited by pain right upper extremity. Motor strength is 4+/5 on right finger flexor's, 4/5 on right grip, finger extensor's, wrist flexor's and wrist extensor's, and 4-/5 to right elbow flexor's, elbow extensor's and shoulder abduction.
Sensation to light touch is decreased over the C5 and C6 upper extremity dermatomes on the right side.
IW was diagnosed with other spondylosis with myelopathy of the cervical region, postlaminectomy syndrome and cervical
…show more content…
Patient has failed gabapentin, nortriptyline and Lyrica. Patient reports greater than 50% relief and is able to sleep 7 hours compare to 3-4 hours without Cymbalta. Nucynta intermediate release (IR) is for breakthrough pain control and Nucynta extended release (ER) for long acting pain control. Nucynta has been very effective for her pain. Patient notes that the medication is helpful to get through the day. Patient notes that with medications, she can get groceries and run errands and reports an increase of activity. She states that without the medications she is less active. It was further noted that these medications are intended for use together (one is short acting and one is long

Related Documents

  • Improved Essays

    Pelvis is stable. The patient is ambulatory and show no restrictions in motion at the hip, knee, ankle, or foot. Examination of the left upper extremity shows a posterior splint. This is removed and shows some mild swelling and ecchymoses in and around the posterior aspect of the elbow and ulnar forearm. Axillary, radial, median, and ulnar nerves are intact to motor and sensory tone.…

    • 598 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    Mr Jetke Case Summary

    • 620 Words
    • 3 Pages

    Dr. Scott thought the pain was from the C5. Dr. Giancarlo indicated that his testing revealed mild carpal tunnel not related to the neck…

    • 620 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    I am writing to provide you with an updated status concerning the above-referenced industrial injury case. Applicant’s Attorney’s Request for a Supplemental Report from Panel Qualified Medical Evaluator, Dr. Timothy Brox As you may recall, a letter was sent to the applicant’s attorney’s office requesting the status of the request for a supplemental report from PQME, Dr. Brox. In our letter, I indicated if no response was received within 30 days of the letter, we would be filing a Declaration of Readiness to Proceed to a Mandatory Settlement Conference based on the reporting of Dr. Brox. No response has been received from the applicant’s attorney’s office.…

    • 467 Words
    • 2 Pages
    Improved Essays
  • Improved Essays

    She stated that she was being treated with a chiropractor for 4 years and responded favorably to chiropractic treatment but it seemed slower than expected. Electrical stimulation therapy was applied over the low back and neck as well as manual therapy over the right shoulder. Treatment plan included spinal adjustment 3-4 regions at the level of C2, C4, T3, T7, L5, and sacrum and chiropractic manipulation to both wrists and shoulders. She was diagnosed with low back pain, pain in thoracic spine, cervicalgia, myalgia, and pain in the right shoulder. She was advised to continue PT modalities and procedures, pain/anti-inflammatory medicine, and was referred to family doctor for pain management.…

    • 296 Words
    • 2 Pages
    Improved Essays
  • Improved Essays

    Iw Case Studies

    • 651 Words
    • 3 Pages

    Acupuncture needling was performed on this visit, as well as gentle stretches performed after the treatment. IW will continue acupuncture and PT. Based on the medical report dated 12/29/16, the patient complains of active lumbar pain, rated 6-7/10 with active and worse right leg radiculopathy, rated 6-8/10. Right leg is noted to have weakness, with history of buckling.…

    • 651 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    Neck Pain Case Studies

    • 715 Words
    • 3 Pages

    This is a 45-year-old male with a 2-20-2015 date of injury. A specific mechanism of injury has not been described. DIAGNOSIS: Sprain of joints and ligaments of unspecified parts of neck, initial encounter 01/11/16 Progress Report describes that 15 minutes were spent in review of the results from the urinary drug screen, which was administered at the previous visit and deciding whether any modifications are appropriate to the treatment regimen. The pain is better and down to a 3/10. The neck pain remained mild.…

    • 715 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    Albert Simpkins Case

    • 975 Words
    • 4 Pages

    We have received the Panel Qualified Medical Evaluation report of Dr. Albert Simpkins, dated February 22, 2017. I believe you were also served with a copy. If that is inaccurate, please let me know, and I will happily forward one to you. Summary Fortunately, Dr. Simpkins found the applicant permanent and stationary for all industrially related body part.…

    • 975 Words
    • 4 Pages
    Improved Essays
  • Improved Essays

    Low Back Pain

    • 708 Words
    • 3 Pages

    On 03/02/2017, the claimant presented with neck and thoracic spine pain rated at 7/10. She presented with some improvement. The plan of care included continued therapy to further increase the range of motion and spinal mobility. The Physical Therapy Note dated 03/06/2017, stated that the claimant felt sick after her last physical therapy session.…

    • 708 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    PCR Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX, ATATACTCGAGCCGCCGCTCCAG). Each tube contained 1X PCR buffer (iNtRON Biotechnology, FroggaBio; 100mM Tris-HCl pH8.3, 500mM KCl, 20mM MgCl2), 10mM dNTP mixture (iNtRON Biotechnology, FroggaBio, 2.5mM each of dATP, dCTP, dGTP, dTTP), 0.05U/µL i-Taq™ DNA polymerase (iNtRON Biotechnology, FroggaBio) and nuclease free water. PCR tubes were placed in an Eppendorf Mastercycler and programmed as follows: 95°C for 5…

    • 742 Words
    • 3 Pages
    Improved Essays
  • Improved Essays

    Ap Psychology Lab

    • 970 Words
    • 4 Pages

    Psychology Lab Research Question: Why do older adults show a decrease on postural control? Hypothesis: Older adults with decreased knee or ankle threshold joint position sensation would show decreased postural control. • Threshold joint position is a test of sensory sensitivity used to quantify each subject’s proprioceptive abilities Methods: • 22 women and men, 70 yoa or older • all subjects had threshold joint position testing at ankle (plantar and dorsiflexion) and knee joints (flexion and extension) - Subjects were told to press a stop button the moment they detected movement in the joint - performance was measured in degree of joint rotation that occurred prior to their sensing movement - This data was used to categorize subjects…

    • 970 Words
    • 4 Pages
    Improved Essays
  • Improved Essays

    Dr. Black Observation

    • 480 Words
    • 2 Pages

    On 3/26/18 I met Ms. Black at the office of Dr. Sardelli. She reports that her shoulder is still painful; she cannot fully extend her elbow or rotate from side to side. She reports pain to the inner aspect of the elbow. Her 4th and 5th fingers cannot open fully or close fully. There continues to be a pain in the inner elbow.…

    • 480 Words
    • 2 Pages
    Improved Essays
  • Superior Essays

    On examination, the patient has normal strength and tone. No involuntary movements are noted. Her movements appear purposeful and normal, specifically there is no tremor or shaking and they are not slow. No fasciculations are noted. Tapping muscle tendons elicits a normal…

    • 1545 Words
    • 6 Pages
    Superior Essays
  • Improved Essays

    Pain Assessment

    • 654 Words
    • 3 Pages

    I am choosing these types of studies to explore the relationship between pain management and patient satisfaction. I will also use previously found data to compare with data I will collect myself. My population will be anesthesiology patients at WellStar Cobb Hospital. According to Diane Glowacki, an RN, MSN, CNS, and CNRN-CMC, self-reported patient pain assessments seem to be an important component in administering proper pain relief and providing adequate pain management (2015). Although healthcare professionals have been using the pain assessment scale for years, the pain assessments subjectivity is a common complaint (Glowacki, 2015).…

    • 654 Words
    • 3 Pages
    Improved Essays
  • Decent Essays

    Radial Nerve Palsy Essay

    • 442 Words
    • 2 Pages

    Orthosis for Radial Nerve Palsy Clients, who sustain damage to the radial nerve experience a significant loss in functional use of the hand. Radial nerve is the most commonly injured nerve of the upper extremity. Orthotic fabrication for an individual with radial nerve palsy requires a balance between protecting the skin while trying to provide increased function for the extremity. Radial nerve palsy depends a lot on where the nerve is damaged. Description of the radial nerve palsy orthosis: • Hand and wrist in neutral alignment, the wrist in slight extension • Length of orthosis is two-thirds the length of the forearm • Wrist: Approximately 10 to 20 degrees extension • Index through small MCPs: Neutral • Thumb:…

    • 442 Words
    • 2 Pages
    Decent Essays
  • Great Essays

    Ms. Iversen is dependent on some dressing, bathing, hair washing, meal preparation, house cleaning. She is non weight bearing to the right leg. MEDICAL/SURGICAL HISTORY Ms. Iversen said she has ha history of cervical pain. She has a congenital fusion of the cervical spine. Ms. Iversen denied any smoking, alcohol use or drug use.…

    • 934 Words
    • 4 Pages
    Great Essays