PCR Amplification
Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX, ATATACTCGAGCCGCCGCTCCAG). Each tube contained 1X PCR buffer (iNtRON Biotechnology, FroggaBio; 100mM Tris-HCl pH8.3, 500mM KCl, 20mM MgCl2), 10mM dNTP mixture (iNtRON Biotechnology, FroggaBio, 2.5mM each of dATP, dCTP, dGTP, dTTP), 0.05U/µL i-Taq™ DNA polymerase (iNtRON Biotechnology, FroggaBio) and nuclease free water. PCR tubes were placed in an Eppendorf Mastercycler and programmed as follows: 95°C for 5 …show more content…
After cooling to 60°C, 1X GelRed (Biotium) was added, and the solution was poured into a gel casting tray with a 15-lane comb. Once the gel had set, it was placed in the running apparatus (Bio-Rad) and submerged with 1X TAE buffer. DNA samples were prepared for loading by adding 1X DNA loading buffer (Fermentas, Life Technologies, 10mM Tris-HCl (pH7.6), 0.03% bromophenol blue, 0.03% xylene cyanol, 60% glycerol, 60mM EDTA). A 1kb ladder was loaded first followed by the DNA samples. The gel was operated at 100 volts for 30 minutes, and the results were visualized using a UV transilluminator (Kodak EDAS 290).
PCR Purification
This was done using the PureLink™ Quick Gel Extraction and PCR Purification Combo Kit (catalog #K220001) as described in manufactures protocol7. Nuclease free water was substituted for the elution buffer.
DNA
Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX, ATATACTCGAGCCGCCGCTCCAG). Each tube contained 1X PCR buffer (iNtRON Biotechnology, FroggaBio; 100mM Tris-HCl pH8.3, 500mM KCl, 20mM MgCl2), 10mM dNTP mixture (iNtRON Biotechnology, FroggaBio, 2.5mM each of dATP, dCTP, dGTP, dTTP), 0.05U/µL i-Taq™ DNA polymerase (iNtRON Biotechnology, FroggaBio) and nuclease free water. PCR tubes were placed in an Eppendorf Mastercycler and programmed as follows: 95°C for 5 …show more content…
After cooling to 60°C, 1X GelRed (Biotium) was added, and the solution was poured into a gel casting tray with a 15-lane comb. Once the gel had set, it was placed in the running apparatus (Bio-Rad) and submerged with 1X TAE buffer. DNA samples were prepared for loading by adding 1X DNA loading buffer (Fermentas, Life Technologies, 10mM Tris-HCl (pH7.6), 0.03% bromophenol blue, 0.03% xylene cyanol, 60% glycerol, 60mM EDTA). A 1kb ladder was loaded first followed by the DNA samples. The gel was operated at 100 volts for 30 minutes, and the results were visualized using a UV transilluminator (Kodak EDAS 290).
PCR Purification
This was done using the PureLink™ Quick Gel Extraction and PCR Purification Combo Kit (catalog #K220001) as described in manufactures protocol7. Nuclease free water was substituted for the elution buffer.
DNA